photography documentaries
in [Digital Cameras]
|
From: sobriquet on 21 Jun 2010 00:03 On 21 jun, 05:25, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > "sobriquet" <dohduh...(a)yahoo.com> wrote in message > > news:a4ff3ca1-1cef-4348-8ade-686f85058996(a)a30g2000yqn.googlegroups.com... > > > > > > > On 21 jun, 04:01, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > >> The thing is, we are not currently living in the wee hours of > >> civilization. > > >> A lot of water has passed under our collective bridges, and society has > >> evolved. > > >> True, we might all benefit from more sharing, but we've developed a > >> rather > >> extensive, codified system of determining who gets what resources for the > >> various aspects of the creative / productive / corporate process. > > >> Those who don't like our current system are usually free to suggest > >> alternative systems, and the procedure for approving and implementing > >> those > >> changes is exhaustively spelled out in the various constitutions of > >> affected > >> countries. > > >> Good Luck persuading everybody your idea is better... > > >> Take Care, > >> Dudley > > > Well, the internet was invented by scientists and it was specifically > > designed in order to share information in the most efficient way. > > So corporations are unlikely to succeed in perverting the essential > > nature of information technology, but they are seriously impairing our > > ability to exploit the full potential of information technology. > > > The internet is simply the ultimate virtual library, where you can > > find virtually everything and you never need to return anything. > > For people who grow up with information technology it's completely > > natural that they are free to share information as they please, > > without much regard for intellectual property laws, as intellectual > > property laws primarily serve corporations who misguidedly believe the > > internet was invented in order to make it easier for them to deprive > > people of their cash. > > Also, digital information on the internet is nothing more or less than > > a long string of bits, like 0010111011100000011101011110001, just like > > a piece of DNA is simply a string composed of 4 possible nucleotides, > > e.g. ACAAGTGGGGTAAAAAACCCATTTACGGGATTAGTTACTGAGATCCCCC. > > So when you think about the idea of people or corporations being > > allowed to own such abstractions as private property, you should be > > able to figure out how that is never going to work out in practice, > > given the ease with which we're able to share and distribute such > > digital items of information and given the fact that people are > > allowed to employ encryption or methods to share information > > anonymously. > > > The intellectual property laws are inconsistent and incoherent as > > there is no sensible way to distinguish between proprietary > > information owned by corporations and information in the public > > domain that is freely accessible. > > If it was up to corporations, they would claim that all information > > belongs to corporations and there would be no public domain > > whatsoever. If it was up to individuals like me, it would be illegal > > for corporations to claim any information as their exclusive > > intellectual property. What's needed is a middle way and that's only > > possible with a neutral and transparent government that guarantees > > human rights instead of perpetually violating them. > > The current financial crisis is kind of illustrative of the kind of > > problems you run into when the government is more or less owned by > > corporations. > > > Hopefully in the end human rights will prevail and impose sensible > > limits on the activities of corporations, where corporate interests > > are conflicting with the interests of individuals or society in > > general. > > > A lot of the conflict regarding intellectual property is about > > controlling the flow of information and corporations who provide > > services that have become completely redundant with the advent of > > information technology. The whole distribution chain from where they > > reproduce books or cds all the way until the books or cds have been > > distributed to a retail store, has become more or less superfluous as > > the internet allows information to reproduce, distribute and promote > > itself. The only catch is that it's virtually impossible to impose > > controls on the whole distribution process and that's why corporations > > who were used to being in control of the distribution process find it > > very hard to accept that they have more or less become redundant as > > middlemen between the creative people who produce content and allow > > themselves to be prostituted by the intellectual property mafia and > > the consumers who enjoy their creative output. > > > Anyone with a talent can simply distribute their stuff online and that > > way they have a direct connection with their fans and supporters on a > > global scale and that is naturally a preferable way to conduct their > > business. The apparent downside is that once they release their > > content, they can't really impose controls on what people are allowed > > to do with their creations, but it has basically always been that way > > for physical products, so it would be a good thing if this once again > > holds for immaterial products like information. > > > Imagine you buy a loaf of bread and you have to accept a 30 page end- > > user-license-agreement where the baker specifies what sort of things > > your allowed to put on the bread and other silly restrictions. People > > would simply ignore it as the natural state of affairs is that once > > you buy a product, you're free to do with it as you please. > > You could buy a piece of artwork and burn it, eat it, hang it on your > > wall or whatever. It's ludicrous to suppose that the artist can impose > > arbitrary restrictions on how you're allowed to use it, like telling > > people they are not allowed to hang the artwork in plain sight in > > front of their window. > > > So all these perversions and ludicrous distortions of creative rights > > are simply the result of corporations ruthlessly exploiting the > > mechanized and centralized reproduction and distribution of > > information, starting with the printing press and it will be a relief > > if we finally get rid of this anomalous state of affairs that is > > completely unnatural compared to the usual way products find their way > > to their respective consumers and reasonable guidelines a producer can > > advise regarding the use of their products (rather than silly > > constraints imposed by producers on the use of their products). > > I must most respectfully disagree that corporations / businesses are > impairing our ability to desseminate information. > > While the internet has its origins in the academic world, the research was > driven / funded by corporate donations which were allocated to business > faculties as well as more traditional scientific departments. > > Furthering the aims of businesses through networking was as much on the > minds of those scientists as linking telescopes and physics departments. > > To get a look at how closely university faculty members and business growth > can be related, just look into the history of Netscape. > > Take Care, > Dudley It wasn't the intellectual property mafia that funded the development of information technology for sure. But issues with copyright infringement and intellectual property predate the internet and the invention of video recorders and xerox machines have also been undermining the power and control of publishers over the reproduction and distribution of information. So it's not that corporations are completely antithetical to the freedom to share information or free access to information, as some businesses clearly make a buck by inventing and selling technology that empowers individuals by enabling them to reproduce and disseminate information as they see fit. Just like Google is a corporation that strives to make information more accessible by making it freely (though often partially) available online, which has put it on a collision course with traditional publishers who are very much opposed to the idea of information being more accessible if it doesn't involve them making a profit from it. http://www.digitaltrends.com/computing/googles-book-scanning-is-angering-publishers/
From: Dudley Hanks on 21 Jun 2010 00:06 "sobriquet" <dohduhdah(a)yahoo.com> wrote in message news:f8cc43f3-d9f2-4994-87ad-1b4b7cf6a8e6(a)x21g2000yqa.googlegroups.com... On 21 jun, 05:25, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > "sobriquet" <dohduh...(a)yahoo.com> wrote in message > > news:a4ff3ca1-1cef-4348-8ade-686f85058996(a)a30g2000yqn.googlegroups.com... > > > > > > > On 21 jun, 04:01, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > >> The thing is, we are not currently living in the wee hours of > >> civilization. > > >> A lot of water has passed under our collective bridges, and society has > >> evolved. > > >> True, we might all benefit from more sharing, but we've developed a > >> rather > >> extensive, codified system of determining who gets what resources for > >> the > >> various aspects of the creative / productive / corporate process. > > >> Those who don't like our current system are usually free to suggest > >> alternative systems, and the procedure for approving and implementing > >> those > >> changes is exhaustively spelled out in the various constitutions of > >> affected > >> countries. > > >> Good Luck persuading everybody your idea is better... > > >> Take Care, > >> Dudley > > > Well, the internet was invented by scientists and it was specifically > > designed in order to share information in the most efficient way. > > So corporations are unlikely to succeed in perverting the essential > > nature of information technology, but they are seriously impairing our > > ability to exploit the full potential of information technology. > > > The internet is simply the ultimate virtual library, where you can > > find virtually everything and you never need to return anything. > > For people who grow up with information technology it's completely > > natural that they are free to share information as they please, > > without much regard for intellectual property laws, as intellectual > > property laws primarily serve corporations who misguidedly believe the > > internet was invented in order to make it easier for them to deprive > > people of their cash. > > Also, digital information on the internet is nothing more or less than > > a long string of bits, like 0010111011100000011101011110001, just like > > a piece of DNA is simply a string composed of 4 possible nucleotides, > > e.g. ACAAGTGGGGTAAAAAACCCATTTACGGGATTAGTTACTGAGATCCCCC. > > So when you think about the idea of people or corporations being > > allowed to own such abstractions as private property, you should be > > able to figure out how that is never going to work out in practice, > > given the ease with which we're able to share and distribute such > > digital items of information and given the fact that people are > > allowed to employ encryption or methods to share information > > anonymously. > > > The intellectual property laws are inconsistent and incoherent as > > there is no sensible way to distinguish between proprietary > > information owned by corporations and information in the public > > domain that is freely accessible. > > If it was up to corporations, they would claim that all information > > belongs to corporations and there would be no public domain > > whatsoever. If it was up to individuals like me, it would be illegal > > for corporations to claim any information as their exclusive > > intellectual property. What's needed is a middle way and that's only > > possible with a neutral and transparent government that guarantees > > human rights instead of perpetually violating them. > > The current financial crisis is kind of illustrative of the kind of > > problems you run into when the government is more or less owned by > > corporations. > > > Hopefully in the end human rights will prevail and impose sensible > > limits on the activities of corporations, where corporate interests > > are conflicting with the interests of individuals or society in > > general. > > > A lot of the conflict regarding intellectual property is about > > controlling the flow of information and corporations who provide > > services that have become completely redundant with the advent of > > information technology. The whole distribution chain from where they > > reproduce books or cds all the way until the books or cds have been > > distributed to a retail store, has become more or less superfluous as > > the internet allows information to reproduce, distribute and promote > > itself. The only catch is that it's virtually impossible to impose > > controls on the whole distribution process and that's why corporations > > who were used to being in control of the distribution process find it > > very hard to accept that they have more or less become redundant as > > middlemen between the creative people who produce content and allow > > themselves to be prostituted by the intellectual property mafia and > > the consumers who enjoy their creative output. > > > Anyone with a talent can simply distribute their stuff online and that > > way they have a direct connection with their fans and supporters on a > > global scale and that is naturally a preferable way to conduct their > > business. The apparent downside is that once they release their > > content, they can't really impose controls on what people are allowed > > to do with their creations, but it has basically always been that way > > for physical products, so it would be a good thing if this once again > > holds for immaterial products like information. > > > Imagine you buy a loaf of bread and you have to accept a 30 page end- > > user-license-agreement where the baker specifies what sort of things > > your allowed to put on the bread and other silly restrictions. People > > would simply ignore it as the natural state of affairs is that once > > you buy a product, you're free to do with it as you please. > > You could buy a piece of artwork and burn it, eat it, hang it on your > > wall or whatever. It's ludicrous to suppose that the artist can impose > > arbitrary restrictions on how you're allowed to use it, like telling > > people they are not allowed to hang the artwork in plain sight in > > front of their window. > > > So all these perversions and ludicrous distortions of creative rights > > are simply the result of corporations ruthlessly exploiting the > > mechanized and centralized reproduction and distribution of > > information, starting with the printing press and it will be a relief > > if we finally get rid of this anomalous state of affairs that is > > completely unnatural compared to the usual way products find their way > > to their respective consumers and reasonable guidelines a producer can > > advise regarding the use of their products (rather than silly > > constraints imposed by producers on the use of their products). > > I must most respectfully disagree that corporations / businesses are > impairing our ability to desseminate information. > > While the internet has its origins in the academic world, the research was > driven / funded by corporate donations which were allocated to business > faculties as well as more traditional scientific departments. > > Furthering the aims of businesses through networking was as much on the > minds of those scientists as linking telescopes and physics departments. > > To get a look at how closely university faculty members and business > growth > can be related, just look into the history of Netscape. > > Take Care, > Dudley It wasn't the intellectual property mafia that funded the development of information technology for sure. But issues with copyright infringement and intellectual property predate the internet and the invention of video recorders and xerox machines have also been undermining the power and control of publishers over the reproduction and distribution of information. So it's not that corporations are completely antithetical to the freedom to share information or free access to information, as some businesses clearly make a buck by inventing and selling technology that empowers individuals by enabling them to reproduce and disseminate information as they see fit. Just like Google is a corporation that strives to make information more accessible by making it freely (though often partially) available online, which has put it on a collision course with traditional publishers who are very much opposed to the idea of information being more accessible if it doesn't involve them making a profit from it. http://www.digitaltrends.com/computing/googles-book-scanning-is-angering-publishers/ So? Take Care, Dudley
From: sobriquet on 21 Jun 2010 00:14 On 21 jun, 06:06, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > "sobriquet" <dohduh...(a)yahoo.com> wrote in message > > news:f8cc43f3-d9f2-4994-87ad-1b4b7cf6a8e6(a)x21g2000yqa.googlegroups.com... > On 21 jun, 05:25, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > > > > > > > "sobriquet" <dohduh...(a)yahoo.com> wrote in message > > >news:a4ff3ca1-1cef-4348-8ade-686f85058996(a)a30g2000yqn.googlegroups.com... > > > > On 21 jun, 04:01, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > > >> The thing is, we are not currently living in the wee hours of > > >> civilization. > > > >> A lot of water has passed under our collective bridges, and society has > > >> evolved. > > > >> True, we might all benefit from more sharing, but we've developed a > > >> rather > > >> extensive, codified system of determining who gets what resources for > > >> the > > >> various aspects of the creative / productive / corporate process. > > > >> Those who don't like our current system are usually free to suggest > > >> alternative systems, and the procedure for approving and implementing > > >> those > > >> changes is exhaustively spelled out in the various constitutions of > > >> affected > > >> countries. > > > >> Good Luck persuading everybody your idea is better... > > > >> Take Care, > > >> Dudley > > > > Well, the internet was invented by scientists and it was specifically > > > designed in order to share information in the most efficient way. > > > So corporations are unlikely to succeed in perverting the essential > > > nature of information technology, but they are seriously impairing our > > > ability to exploit the full potential of information technology. > > > > The internet is simply the ultimate virtual library, where you can > > > find virtually everything and you never need to return anything. > > > For people who grow up with information technology it's completely > > > natural that they are free to share information as they please, > > > without much regard for intellectual property laws, as intellectual > > > property laws primarily serve corporations who misguidedly believe the > > > internet was invented in order to make it easier for them to deprive > > > people of their cash. > > > Also, digital information on the internet is nothing more or less than > > > a long string of bits, like 0010111011100000011101011110001, just like > > > a piece of DNA is simply a string composed of 4 possible nucleotides, > > > e.g. ACAAGTGGGGTAAAAAACCCATTTACGGGATTAGTTACTGAGATCCCCC. > > > So when you think about the idea of people or corporations being > > > allowed to own such abstractions as private property, you should be > > > able to figure out how that is never going to work out in practice, > > > given the ease with which we're able to share and distribute such > > > digital items of information and given the fact that people are > > > allowed to employ encryption or methods to share information > > > anonymously. > > > > The intellectual property laws are inconsistent and incoherent as > > > there is no sensible way to distinguish between proprietary > > > information owned by corporations and information in the public > > > domain that is freely accessible. > > > If it was up to corporations, they would claim that all information > > > belongs to corporations and there would be no public domain > > > whatsoever. If it was up to individuals like me, it would be illegal > > > for corporations to claim any information as their exclusive > > > intellectual property. What's needed is a middle way and that's only > > > possible with a neutral and transparent government that guarantees > > > human rights instead of perpetually violating them. > > > The current financial crisis is kind of illustrative of the kind of > > > problems you run into when the government is more or less owned by > > > corporations. > > > > Hopefully in the end human rights will prevail and impose sensible > > > limits on the activities of corporations, where corporate interests > > > are conflicting with the interests of individuals or society in > > > general. > > > > A lot of the conflict regarding intellectual property is about > > > controlling the flow of information and corporations who provide > > > services that have become completely redundant with the advent of > > > information technology. The whole distribution chain from where they > > > reproduce books or cds all the way until the books or cds have been > > > distributed to a retail store, has become more or less superfluous as > > > the internet allows information to reproduce, distribute and promote > > > itself. The only catch is that it's virtually impossible to impose > > > controls on the whole distribution process and that's why corporations > > > who were used to being in control of the distribution process find it > > > very hard to accept that they have more or less become redundant as > > > middlemen between the creative people who produce content and allow > > > themselves to be prostituted by the intellectual property mafia and > > > the consumers who enjoy their creative output. > > > > Anyone with a talent can simply distribute their stuff online and that > > > way they have a direct connection with their fans and supporters on a > > > global scale and that is naturally a preferable way to conduct their > > > business. The apparent downside is that once they release their > > > content, they can't really impose controls on what people are allowed > > > to do with their creations, but it has basically always been that way > > > for physical products, so it would be a good thing if this once again > > > holds for immaterial products like information. > > > > Imagine you buy a loaf of bread and you have to accept a 30 page end- > > > user-license-agreement where the baker specifies what sort of things > > > your allowed to put on the bread and other silly restrictions. People > > > would simply ignore it as the natural state of affairs is that once > > > you buy a product, you're free to do with it as you please. > > > You could buy a piece of artwork and burn it, eat it, hang it on your > > > wall or whatever. It's ludicrous to suppose that the artist can impose > > > arbitrary restrictions on how you're allowed to use it, like telling > > > people they are not allowed to hang the artwork in plain sight in > > > front of their window. > > > > So all these perversions and ludicrous distortions of creative rights > > > are simply the result of corporations ruthlessly exploiting the > > > mechanized and centralized reproduction and distribution of > > > information, starting with the printing press and it will be a relief > > > if we finally get rid of this anomalous state of affairs that is > > > completely unnatural compared to the usual way products find their way > > > to their respective consumers and reasonable guidelines a producer can > > > advise regarding the use of their products (rather than silly > > > constraints imposed by producers on the use of their products). > > > I must most respectfully disagree that corporations / businesses are > > impairing our ability to desseminate information. > > > While the internet has its origins in the academic world, the research was > > driven / funded by corporate donations which were allocated to business > > faculties as well as more traditional scientific departments. > > > Furthering the aims of businesses through networking was as much on the > > minds of those scientists as linking telescopes and physics departments. > > > To get a look at how closely university faculty members and business > > growth > > can be related, just look into the history of Netscape. > > > Take Care, > > Dudley > > It wasn't the intellectual property mafia that funded the development > of information technology for sure. > But issues with copyright infringement and intellectual property > predate the internet and the invention of video recorders and xerox > machines have also been undermining the power and control of > publishers over the reproduction and distribution of information. > > So it's not that corporations are completely antithetical to the > freedom to share information or free access to information, as some > businesses clearly make a buck by inventing and selling technology > that empowers individuals by enabling them to reproduce and > disseminate information as they see fit. > > Just like Google is a corporation that strives to make information > more accessible by making it freely (though often partially) available > online, which has put it on a collision course with traditional > publishers who are very much opposed to the idea of information being > more accessible if it doesn't involve them making a profit from it. > > http://www.digitaltrends.com/computing/googles-book-scanning-is-anger... > > So? > > Take Care, > Dudley So it's not corporations in general, but rather the intellectual property mafia that is impairing our ability to exploit the full potential of information technology, and it's not like there is a clear-cut dichotomy between the interests of corporations and the interests of individual people like me, who are very much in favor of the freedom to share information regardless of any spurious intellectual property claims.
From: sobriquet on 21 Jun 2010 00:26 On 20 jun, 21:17, krishnananda <kris...(a)divine-life.in.invalid> wrote: > In article > <cac3bbbd-cf7e-4fea-a2e7-6ba4e6c5b...(a)y4g2000yqy.googlegroups.com>, > > sobriquet <dohduh...(a)gmail.com> wrote: > > Don't worry, given your incoherent and nonsensical arguments, your > > garbled spelling is amongst the least of your worries. First you > > should strive to master an ability to express your point of view in a > > fashion that is intelligible to others and then you can gain bonus > > points for extra credibility if you manage to spell out your ideas > > flawlessly. > > > I recommend this course in particular: > >http://thepiratebay.org/torrent/4919006/TTC_VIDEO_-_Argumentation__Th... > > f_Effective_Reasoning_2nd_ > > YOU HAVE JUST ADVOCATED WHAT IS A PLAIN VIOLATION OF GOOGLE GROUPS TERMS > OF SERVICE, THAT IS, STEALING AND PROMULGATING SOFTWARE YOU HAVE NO > AUTHORSHIP INTEREST IN. THIS IS A CRIME IN MOST COUNTRIES OF THE WORLD. > > YOUR NNTP POSTING ADDRESS 85.113.251.186 HAS BEEN REPORTED TO GOOGLE FOR > INDEFINITE BANNING DUE TO GROSS VIOLATIONS OF GOOGLE'S TOS. Where I live, it happens to be perfectly legal to download most things (like books, music, videos, etc..) for personal use. Hence, I haven't advocated any criminal activity whatsoever by mentioning a weblink to a video available on p2p networks. Good luck convincing google to suspend my account! I won't be holding my breath. :-)
From: Dudley Hanks on 21 Jun 2010 00:27
"sobriquet" <dohduhdah(a)yahoo.com> wrote in message news:c2a7d028-9ba2-4542-ae12-86b7983f71e2(a)u26g2000yqu.googlegroups.com... > On 21 jun, 06:06, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: >> "sobriquet" <dohduh...(a)yahoo.com> wrote in message >> >> news:f8cc43f3-d9f2-4994-87ad-1b4b7cf6a8e6(a)x21g2000yqa.googlegroups.com... >> On 21 jun, 05:25, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: >> >> >> >> >> >> > "sobriquet" <dohduh...(a)yahoo.com> wrote in message >> >> >news:a4ff3ca1-1cef-4348-8ade-686f85058996(a)a30g2000yqn.googlegroups.com... >> >> > > On 21 jun, 04:01, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: >> > >> The thing is, we are not currently living in the wee hours of >> > >> civilization. >> >> > >> A lot of water has passed under our collective bridges, and society >> > >> has >> > >> evolved. >> >> > >> True, we might all benefit from more sharing, but we've developed a >> > >> rather >> > >> extensive, codified system of determining who gets what resources >> > >> for >> > >> the >> > >> various aspects of the creative / productive / corporate process. >> >> > >> Those who don't like our current system are usually free to suggest >> > >> alternative systems, and the procedure for approving and >> > >> implementing >> > >> those >> > >> changes is exhaustively spelled out in the various constitutions of >> > >> affected >> > >> countries. >> >> > >> Good Luck persuading everybody your idea is better... >> >> > >> Take Care, >> > >> Dudley >> >> > > Well, the internet was invented by scientists and it was specifically >> > > designed in order to share information in the most efficient way. >> > > So corporations are unlikely to succeed in perverting the essential >> > > nature of information technology, but they are seriously impairing >> > > our >> > > ability to exploit the full potential of information technology. >> >> > > The internet is simply the ultimate virtual library, where you can >> > > find virtually everything and you never need to return anything. >> > > For people who grow up with information technology it's completely >> > > natural that they are free to share information as they please, >> > > without much regard for intellectual property laws, as intellectual >> > > property laws primarily serve corporations who misguidedly believe >> > > the >> > > internet was invented in order to make it easier for them to deprive >> > > people of their cash. >> > > Also, digital information on the internet is nothing more or less >> > > than >> > > a long string of bits, like 0010111011100000011101011110001, just >> > > like >> > > a piece of DNA is simply a string composed of 4 possible nucleotides, >> > > e.g. ACAAGTGGGGTAAAAAACCCATTTACGGGATTAGTTACTGAGATCCCCC. >> > > So when you think about the idea of people or corporations being >> > > allowed to own such abstractions as private property, you should be >> > > able to figure out how that is never going to work out in practice, >> > > given the ease with which we're able to share and distribute such >> > > digital items of information and given the fact that people are >> > > allowed to employ encryption or methods to share information >> > > anonymously. >> >> > > The intellectual property laws are inconsistent and incoherent as >> > > there is no sensible way to distinguish between proprietary >> > > information owned by corporations and information in the public >> > > domain that is freely accessible. >> > > If it was up to corporations, they would claim that all information >> > > belongs to corporations and there would be no public domain >> > > whatsoever. If it was up to individuals like me, it would be illegal >> > > for corporations to claim any information as their exclusive >> > > intellectual property. What's needed is a middle way and that's only >> > > possible with a neutral and transparent government that guarantees >> > > human rights instead of perpetually violating them. >> > > The current financial crisis is kind of illustrative of the kind of >> > > problems you run into when the government is more or less owned by >> > > corporations. >> >> > > Hopefully in the end human rights will prevail and impose sensible >> > > limits on the activities of corporations, where corporate interests >> > > are conflicting with the interests of individuals or society in >> > > general. >> >> > > A lot of the conflict regarding intellectual property is about >> > > controlling the flow of information and corporations who provide >> > > services that have become completely redundant with the advent of >> > > information technology. The whole distribution chain from where they >> > > reproduce books or cds all the way until the books or cds have been >> > > distributed to a retail store, has become more or less superfluous as >> > > the internet allows information to reproduce, distribute and promote >> > > itself. The only catch is that it's virtually impossible to impose >> > > controls on the whole distribution process and that's why >> > > corporations >> > > who were used to being in control of the distribution process find it >> > > very hard to accept that they have more or less become redundant as >> > > middlemen between the creative people who produce content and allow >> > > themselves to be prostituted by the intellectual property mafia and >> > > the consumers who enjoy their creative output. >> >> > > Anyone with a talent can simply distribute their stuff online and >> > > that >> > > way they have a direct connection with their fans and supporters on a >> > > global scale and that is naturally a preferable way to conduct their >> > > business. The apparent downside is that once they release their >> > > content, they can't really impose controls on what people are allowed >> > > to do with their creations, but it has basically always been that way >> > > for physical products, so it would be a good thing if this once again >> > > holds for immaterial products like information. >> >> > > Imagine you buy a loaf of bread and you have to accept a 30 page end- >> > > user-license-agreement where the baker specifies what sort of things >> > > your allowed to put on the bread and other silly restrictions. People >> > > would simply ignore it as the natural state of affairs is that once >> > > you buy a product, you're free to do with it as you please. >> > > You could buy a piece of artwork and burn it, eat it, hang it on your >> > > wall or whatever. It's ludicrous to suppose that the artist can >> > > impose >> > > arbitrary restrictions on how you're allowed to use it, like telling >> > > people they are not allowed to hang the artwork in plain sight in >> > > front of their window. >> >> > > So all these perversions and ludicrous distortions of creative rights >> > > are simply the result of corporations ruthlessly exploiting the >> > > mechanized and centralized reproduction and distribution of >> > > information, starting with the printing press and it will be a relief >> > > if we finally get rid of this anomalous state of affairs that is >> > > completely unnatural compared to the usual way products find their >> > > way >> > > to their respective consumers and reasonable guidelines a producer >> > > can >> > > advise regarding the use of their products (rather than silly >> > > constraints imposed by producers on the use of their products). >> >> > I must most respectfully disagree that corporations / businesses are >> > impairing our ability to desseminate information. >> >> > While the internet has its origins in the academic world, the research >> > was >> > driven / funded by corporate donations which were allocated to business >> > faculties as well as more traditional scientific departments. >> >> > Furthering the aims of businesses through networking was as much on the >> > minds of those scientists as linking telescopes and physics >> > departments. >> >> > To get a look at how closely university faculty members and business >> > growth >> > can be related, just look into the history of Netscape. >> >> > Take Care, >> > Dudley >> >> It wasn't the intellectual property mafia that funded the development >> of information technology for sure. >> But issues with copyright infringement and intellectual property >> predate the internet and the invention of video recorders and xerox >> machines have also been undermining the power and control of >> publishers over the reproduction and distribution of information. >> >> So it's not that corporations are completely antithetical to the >> freedom to share information or free access to information, as some >> businesses clearly make a buck by inventing and selling technology >> that empowers individuals by enabling them to reproduce and >> disseminate information as they see fit. >> >> Just like Google is a corporation that strives to make information >> more accessible by making it freely (though often partially) available >> online, which has put it on a collision course with traditional >> publishers who are very much opposed to the idea of information being >> more accessible if it doesn't involve them making a profit from it. >> >> http://www.digitaltrends.com/computing/googles-book-scanning-is-anger... >> >> So? >> >> Take Care, >> Dudley > > So it's not corporations in general, but rather the intellectual > property mafia that is impairing our ability to exploit the full > potential of information technology, and it's not like there is a > clear-cut dichotomy between the interests of corporations and the > interests of individual people like me, who are very much in favor of > the freedom to share information regardless of any spurious > intellectual property claims. On a sentimental level, I wish you luck... But, I still don't see any major issue. Well, not quite. It saddens me to hear that the University of Alberta is doing great things with a generic drug which has huge potential to help brain cancer patients, but corporations won't fund research because the drug is generic and can't be patented. But, as stated in the article, others have stepped up, and it will be interesting to see what happens. Anybody out there with some extra bucks and a friend who might benefit from the drug should think about donating... http://www.cbc.ca/health/story/2010/05/12/dca-brain-cancer.html Take Care, Dudley |