|
From: sobriquet on 21 Jun 2010 00:52 On 21 jun, 06:27, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > "sobriquet" <dohduh...(a)yahoo.com> wrote in message > > news:c2a7d028-9ba2-4542-ae12-86b7983f71e2(a)u26g2000yqu.googlegroups.com... > > > On 21 jun, 06:06, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > >> "sobriquet" <dohduh...(a)yahoo.com> wrote in message > > >>news:f8cc43f3-d9f2-4994-87ad-1b4b7cf6a8e6(a)x21g2000yqa.googlegroups.com.... > >> On 21 jun, 05:25, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > > >> > "sobriquet" <dohduh...(a)yahoo.com> wrote in message > > >> >news:a4ff3ca1-1cef-4348-8ade-686f85058996(a)a30g2000yqn.googlegroups.com... > > >> > > On 21 jun, 04:01, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > >> > >> The thing is, we are not currently living in the wee hours of > >> > >> civilization. > > >> > >> A lot of water has passed under our collective bridges, and society > >> > >> has > >> > >> evolved. > > >> > >> True, we might all benefit from more sharing, but we've developed a > >> > >> rather > >> > >> extensive, codified system of determining who gets what resources > >> > >> for > >> > >> the > >> > >> various aspects of the creative / productive / corporate process. > > >> > >> Those who don't like our current system are usually free to suggest > >> > >> alternative systems, and the procedure for approving and > >> > >> implementing > >> > >> those > >> > >> changes is exhaustively spelled out in the various constitutions of > >> > >> affected > >> > >> countries. > > >> > >> Good Luck persuading everybody your idea is better... > > >> > >> Take Care, > >> > >> Dudley > > >> > > Well, the internet was invented by scientists and it was specifically > >> > > designed in order to share information in the most efficient way. > >> > > So corporations are unlikely to succeed in perverting the essential > >> > > nature of information technology, but they are seriously impairing > >> > > our > >> > > ability to exploit the full potential of information technology. > > >> > > The internet is simply the ultimate virtual library, where you can > >> > > find virtually everything and you never need to return anything. > >> > > For people who grow up with information technology it's completely > >> > > natural that they are free to share information as they please, > >> > > without much regard for intellectual property laws, as intellectual > >> > > property laws primarily serve corporations who misguidedly believe > >> > > the > >> > > internet was invented in order to make it easier for them to deprive > >> > > people of their cash. > >> > > Also, digital information on the internet is nothing more or less > >> > > than > >> > > a long string of bits, like 0010111011100000011101011110001, just > >> > > like > >> > > a piece of DNA is simply a string composed of 4 possible nucleotides, > >> > > e.g. ACAAGTGGGGTAAAAAACCCATTTACGGGATTAGTTACTGAGATCCCCC. > >> > > So when you think about the idea of people or corporations being > >> > > allowed to own such abstractions as private property, you should be > >> > > able to figure out how that is never going to work out in practice, > >> > > given the ease with which we're able to share and distribute such > >> > > digital items of information and given the fact that people are > >> > > allowed to employ encryption or methods to share information > >> > > anonymously. > > >> > > The intellectual property laws are inconsistent and incoherent as > >> > > there is no sensible way to distinguish between proprietary > >> > > information owned by corporations and information in the public > >> > > domain that is freely accessible. > >> > > If it was up to corporations, they would claim that all information > >> > > belongs to corporations and there would be no public domain > >> > > whatsoever. If it was up to individuals like me, it would be illegal > >> > > for corporations to claim any information as their exclusive > >> > > intellectual property. What's needed is a middle way and that's only > >> > > possible with a neutral and transparent government that guarantees > >> > > human rights instead of perpetually violating them. > >> > > The current financial crisis is kind of illustrative of the kind of > >> > > problems you run into when the government is more or less owned by > >> > > corporations. > > >> > > Hopefully in the end human rights will prevail and impose sensible > >> > > limits on the activities of corporations, where corporate interests > >> > > are conflicting with the interests of individuals or society in > >> > > general. > > >> > > A lot of the conflict regarding intellectual property is about > >> > > controlling the flow of information and corporations who provide > >> > > services that have become completely redundant with the advent of > >> > > information technology. The whole distribution chain from where they > >> > > reproduce books or cds all the way until the books or cds have been > >> > > distributed to a retail store, has become more or less superfluous as > >> > > the internet allows information to reproduce, distribute and promote > >> > > itself. The only catch is that it's virtually impossible to impose > >> > > controls on the whole distribution process and that's why > >> > > corporations > >> > > who were used to being in control of the distribution process find it > >> > > very hard to accept that they have more or less become redundant as > >> > > middlemen between the creative people who produce content and allow > >> > > themselves to be prostituted by the intellectual property mafia and > >> > > the consumers who enjoy their creative output. > > >> > > Anyone with a talent can simply distribute their stuff online and > >> > > that > >> > > way they have a direct connection with their fans and supporters on a > >> > > global scale and that is naturally a preferable way to conduct their > >> > > business. The apparent downside is that once they release their > >> > > content, they can't really impose controls on what people are allowed > >> > > to do with their creations, but it has basically always been that way > >> > > for physical products, so it would be a good thing if this once again > >> > > holds for immaterial products like information. > > >> > > Imagine you buy a loaf of bread and you have to accept a 30 page end- > >> > > user-license-agreement where the baker specifies what sort of things > >> > > your allowed to put on the bread and other silly restrictions. People > >> > > would simply ignore it as the natural state of affairs is that once > >> > > you buy a product, you're free to do with it as you please. > >> > > You could buy a piece of artwork and burn it, eat it, hang it on your > >> > > wall or whatever. It's ludicrous to suppose that the artist can > >> > > impose > >> > > arbitrary restrictions on how you're allowed to use it, like telling > >> > > people they are not allowed to hang the artwork in plain sight in > >> > > front of their window. > > >> > > So all these perversions and ludicrous distortions of creative rights > >> > > are simply the result of corporations ruthlessly exploiting the > >> > > mechanized and centralized reproduction and distribution of > >> > > information, starting with the printing press and it will be a relief > >> > > if we finally get rid of this anomalous state of affairs that is > >> > > completely unnatural compared to the usual way products find their > >> > > way > >> > > to their respective consumers and reasonable guidelines a producer > >> > > can > >> > > advise regarding the use of their products (rather than silly > >> > > constraints imposed by producers on the use of their products). > > >> > I must most respectfully disagree that corporations / businesses are > >> > impairing our ability to desseminate information. > > >> > While the internet has its origins in the academic world, the research > >> > was > >> > driven / funded by corporate donations which were allocated to business > >> > faculties as well as more traditional scientific departments. > > >> > Furthering the aims of businesses through networking was as much on the > >> > minds of those scientists as linking telescopes and physics > >> > departments. > > >> > To get a look at how closely university faculty members and business > >> > growth > >> > can be related, just look into the history of Netscape. > > >> > Take Care, > >> > Dudley > > >> It wasn't the intellectual property mafia that funded the development > >> of information technology for sure. > >> But issues with copyright infringement and intellectual property > >> predate the internet and the invention of video recorders and xerox > >> machines have also been undermining the power and control of > >> publishers over the reproduction and distribution of information. > > >> So it's not that corporations are completely antithetical to the > >> freedom to share information or free access to information, as some > >> businesses clearly make a buck by inventing and selling technology > >> that empowers individuals by enabling them to reproduce and > >> disseminate information as they see fit. > > >> Just like Google is a corporation that strives to make information > >> more accessible by making it freely (though often partially) available > >> online, which has put it on a collision course with traditional > >> publishers who are very much opposed to the idea of information being > >> more accessible if it doesn't involve them making a profit from it. > > >>http://www.digitaltrends.com/computing/googles-book-scanning-is-anger.... > > >> So? > > >> Take Care, > >> Dudley > > > So it's not corporations in general, but rather the intellectual > > property mafia that is impairing our ability to exploit the full > > potential of information technology, and it's not like there is a > > clear-cut dichotomy between the interests of corporations and the > > interests of individual people like me, who are very much in favor of > > the freedom to share information regardless of any spurious > > intellectual property claims. > > On a sentimental level, I wish you luck... > > But, I still don't see any major issue. You might see a major issue if you run into a conflict of interests with major corporations. Imagine you're some individual in the fascist police states of America and you share some mp3s online and they sue you for millions of purported 'damages' to set an example. http://www.cbsnews.com/8301-504083_162-5097090-504083.html That's the contemporary equivalent of a witch being burned at the stake. > > Well, not quite. It saddens me to hear that the University of Alberta is > doing great things with a generic drug which has huge potential to help > brain cancer patients, but corporations won't fund research because the drug > is generic and can't be patented. That's also an issue with intellectual property, but on a different level. Likewise it's a stunning travesty of justice that people are criminalized if they grow some pot at home, while at the same time pharmaceutical companies are pushing their drugs like hardcore drug dealers. > > But, as stated in the article, others have stepped up, and it will be > interesting to see what happens. > > Anybody out there with some extra bucks and a friend who might benefit from > the drug should think about donating... > > http://www.cbc.ca/health/story/2010/05/12/dca-brain-cancer.html > > Take Care, > Dudley
From: whisky-dave on 21 Jun 2010 09:50 "tony cooper" <tony_cooper213(a)earthlink.net> wrote in message news:q51t16hnlr6l8e7nnp3gohv65g9bm9ejh2(a)4ax.com... > On Sun, 20 Jun 2010 15:35:06 -0500, Die Wahrheit > <diewahrheit(a)somewherehonest.net> wrote: > >>On Sun, 20 Jun 2010 13:05:11 -0700, Savageduck >><savageduck1@{REMOVESPAM}me.com> wrote: >> >>>On 2010-06-19 20:44:22 -0700, tony cooper <tony_cooper213(a)earthlink.net> >>>said: >>> >>>> On Sat, 19 Jun 2010 17:14:21 -0700 (PDT), sobriquet >>>> <dohduhdah(a)gmail.com> wrote: >>>> >>>>> Just because people have a swastika on display, that doesn't imply >>>>> they subscribe to the tenets of the national socialist workers party >>>>> in former Nazi Germany. >>>>> >>>> If anyone knows, the Duck knows that if it walks like a duck and >>>> quacks like a duck that it's probably a duck. >>> >>>I haven't seen many Aryan Brotherhood, NLR, Sacramaniac, SkinHead, >>>White Power, or Peckerwood gang members sporting "Buddhist or Hindu >>>swastika" tattoos or decorating their walls with anything other than >>>those we became familiar with since the rise of the NDAP after WWI. >>>Finding a swastika on, or about a subject gives most investigators a >>>pretty good idea of that individual's mindset and philosophy. >> >>Interesting you should say that. I once visited the St. Paul cathedral. > > Which St Paul's? > > If the one in London, Christopher Wren did not anticipate the swastika > design being a symbol of the Nazis hundreds of years later. The swastika sysmbol is 1000s of years old I thought the earlist was record being about 9000 BC. It's also a Hindi symbol as was used in India centuries before Germany used it.
From: whisky-dave on 21 Jun 2010 09:50 "Tim Conway" <tconway_113(a)comcast.net> wrote in message news:hvlukp$jnl$1(a)news.eternal-september.org... > > "Die Wahrheit" <diewahrheit(a)somewherehonest.net> wrote in message > news:7aus1697h0sg90kqjch5so7vkl9rejqju0(a)4ax.com... >> On Sun, 20 Jun 2010 13:05:11 -0700, Savageduck >> <savageduck1@{REMOVESPAM}me.com> wrote: >> >>>On 2010-06-19 20:44:22 -0700, tony cooper <tony_cooper213(a)earthlink.net> >>>said: >>> >>>> On Sat, 19 Jun 2010 17:14:21 -0700 (PDT), sobriquet >>>> <dohduhdah(a)gmail.com> wrote: >>>> >>>>> Just because people have a swastika on display, that doesn't imply >>>>> they subscribe to the tenets of the national socialist workers party >>>>> in former Nazi Germany. >>>>> >>>> If anyone knows, the Duck knows that if it walks like a duck and >>>> quacks like a duck that it's probably a duck. >>> >>>I haven't seen many Aryan Brotherhood, NLR, Sacramaniac, SkinHead, >>>White Power, or Peckerwood gang members sporting "Buddhist or Hindu >>>swastika" tattoos or decorating their walls with anything other than >>>those we became familiar with since the rise of the NDAP after WWI. >>>Finding a swastika on, or about a subject gives most investigators a >>>pretty good idea of that individual's mindset and philosophy. >> >> Interesting you should say that. I once visited the St. Paul cathedral. >> Some of the hallways are completely lined in tiles all arranged in shapes >> of swastikas. Even the dome of the cathedral is decorated in elaborate >> images taken directly from the Major Arcana of a deck of tarot cards. All >> of the dome's images plainly titled with the very same names as those >> tarot >> cards' names. I asked the tour-guide about all of that, the halls of >> swastikas and tarot card's images above all other symbols and designs, >> but >> she had no answers. I guess we now know how all christians think and >> believe. > > Not true christians. I thought all true Christians tasted like chicken
From: J. Caldwell on 21 Jun 2010 10:45 On Mon, 21 Jun 2010 14:50:55 +0100, "whisky-dave" <whisky-dave(a)final.front.ear> wrote: > >"Tim Conway" <tconway_113(a)comcast.net> wrote in message >news:hvlukp$jnl$1(a)news.eternal-september.org... >> >> "Die Wahrheit" <diewahrheit(a)somewherehonest.net> wrote in message >> news:7aus1697h0sg90kqjch5so7vkl9rejqju0(a)4ax.com... >>> On Sun, 20 Jun 2010 13:05:11 -0700, Savageduck >>> <savageduck1@{REMOVESPAM}me.com> wrote: >>> >>>>On 2010-06-19 20:44:22 -0700, tony cooper <tony_cooper213(a)earthlink.net> >>>>said: >>>> >>>>> On Sat, 19 Jun 2010 17:14:21 -0700 (PDT), sobriquet >>>>> <dohduhdah(a)gmail.com> wrote: >>>>> >>>>>> Just because people have a swastika on display, that doesn't imply >>>>>> they subscribe to the tenets of the national socialist workers party >>>>>> in former Nazi Germany. >>>>>> >>>>> If anyone knows, the Duck knows that if it walks like a duck and >>>>> quacks like a duck that it's probably a duck. >>>> >>>>I haven't seen many Aryan Brotherhood, NLR, Sacramaniac, SkinHead, >>>>White Power, or Peckerwood gang members sporting "Buddhist or Hindu >>>>swastika" tattoos or decorating their walls with anything other than >>>>those we became familiar with since the rise of the NDAP after WWI. >>>>Finding a swastika on, or about a subject gives most investigators a >>>>pretty good idea of that individual's mindset and philosophy. >>> >>> Interesting you should say that. I once visited the St. Paul cathedral. >>> Some of the hallways are completely lined in tiles all arranged in shapes >>> of swastikas. Even the dome of the cathedral is decorated in elaborate >>> images taken directly from the Major Arcana of a deck of tarot cards. All >>> of the dome's images plainly titled with the very same names as those >>> tarot >>> cards' names. I asked the tour-guide about all of that, the halls of >>> swastikas and tarot card's images above all other symbols and designs, >>> but >>> she had no answers. I guess we now know how all christians think and >>> believe. >> >> Not true christians. > >I thought all true Christians tasted like chicken > So it's been said, by those smart enough not to fall for their manipulative and disarming "judge not lest ye be judged" con-artist routine. As christians always judged (and still judge) others to death constantly. christians are never happy unless they can find a way to kill someone to appease their beliefs in their god. You know, basic human sacrifice. Their most recent version of this, summed up in their war-cry for human sacrifice being "Let the fags die of AIDS!" And they think that human sacrifice is just something that ancient civilizations have done? Never realizing they've performed it on every continent they've infested in unfathomably far greater numbers than all other civilizations combined all throughout history, even up to the very last few decades, and still today. Hell, some of them even still perform ritualized cannibalism every sunday when they eat their "host" wafers and sip their wine in celebration of human sacrifice. If you don't judge you die. For proof there's four whole continents of missing civilizations where christians taught those civilization to not to judge christians while christians judged them to death. It's that simple.
From: whisky-dave on 21 Jun 2010 11:01
"sobriquet" <dohduhdah(a)yahoo.com> wrote in message news:c2a7d028-9ba2-4542-ae12-86b7983f71e2(a)u26g2000yqu.googlegroups.com... > > So it's not corporations in general, but rather the intellectual > property mafia that is impairing our ability to exploit the full > potential of information technology, and it's not like there is a > clear-cut dichotomy between the interests of corporations and the > interests of individual people like me, who are very much in favor of > the freedom to share information regardless of any spurious > intellectual property claims. But you're only prepared to share other peoples information and intellectual property you never share your own, probably because it's worthless, but as yet I've not seen you share your bank details or anything of any use unless it comes from someone else. |